Protein and Amino Acid
2 pages (500 words) , Essay
Only on StudentShare
...Amino Acid Proteins are the building blocks of human body and are very essential nutrient. Amino acids and the basic units of proteins and are called the building blocks of protein. In general proteins are obtained food sources, such as meats and other animal products such as eggs, cheese and milk. Proteins are broken down into simpler constituents to make it easily for digestion. Amino acids are critical for the proper functioning of the body. Some of the common functions of proteins include repairing muscles, organs, nails, hair, skin, ligaments, and glands (NutraSanus, n.pag, 2004). A lack of amino acids in daily diet will have a greater impact on all cellular development, respiration... Protein and...
How the 22nd amino acid is produced
3 pages (750 words) , Essay
Only on StudentShare
...Amino acid. Introduction The discovery of the extra amino acid in the history of science has sparked heated debate on the validity of the long standing central dogma that argued that the number of amino acids is discrete at twenty, courtesy of the molecular and cell biologists. The new Amino acid is termed as pyrrolysine; it’s synthesized through a chemical reaction that requires a total of three steps. Its precursor molecule is another amino acid called lysine. The process by which the cells make the amino acids has been along time paradox as the Ohio state University under the stewardship of their able scientists endeavored to identify the process of the amino acid synthesis... ? Running head: Amino...
Ing-minske procedure/ amino acid protection/ nucleotide analogues/ stereochemistry/ regioselectivity
4 pages (1000 words) , Essay
Only on StudentShare
...amino acid protection in synthesizing small peptides: Production of peptides in known as “peptide synthesis”, in organic chemistry. However, these organic compounds contain multiple amino acids which are bound together via “peptide” bonds; also known as amide bonds. Synthesis of peptides involves the coupling of carboxyl group or C-terminus of one amino acid to the amino group or N-terminus of another amino acid. In this process unintended reactions are expected, hence there is always a requirement of protecting groups. Chemical synthesis of peptide starts at the C-terminus of the peptide and ends at the N-terminus. The protecting groups are used to prevent polymerization of amino acids... Importance of...
The Role of Amino Acid R-groups to the Structure and Function of Ligand-Protein Complexes
4 pages (1000 words) , Lab Report
Only on StudentShare
...Amino Acid R-groups to the Structure and Function of Ligand-Protein Complexes This paper aims at discussing the molecular structure, the Rf and the binding of various amino acids. The paper discusses also the molecular formula. Introduction There are 20 basic amino acids, which have their molecular structure and bonding. Their rate to front also differs and varies from one amino acid to another. The best procedure used in differentiating amino acids is by determining their rate to front, which is mainly established through the process of chromatography. This process is also distinguished by the intensity of colors on the chromatogram. 1. Amino acid names, molecular weights, Rf values... The Role of...
The Role of Amino Acid R-groups to the Structure and Function of Ligand-Protein Complexes
4 pages (1000 words) , Lab Report
Only on StudentShare
...Amino Acid R-groups to the Structure and Function of Ligand-Protein Complexes This paper aims at discussing the molecular structure, the Rf and the binding of various amino acids. The paper discusses also the molecular formula. Introduction There are 20 basic amino acids, which have their molecular structure and bonding. Their rate to front also differs and varies from one amino acid to another. The best procedure used in differentiating amino acids is by determining their rate to front, which is mainly established through the process of chromatography. This process is also distinguished by the intensity of colors on the chromatogram. 1. Amino acid names, molecular weights, Rf values... The Role of...
High Protein Diets: Metabolic Poison for those with Inborn Errors of Amino Acid Metabolism
8 pages (2000 words) , Essay
Only on StudentShare
...Amino acids are the building blocks of proteins but a diet high in protein can also lead to other problems like nephrolithiasis and osteoporosis. Inborn errors of metabolism are hereditary diseases in which the cellular metabolism is abnormal due to an inherited defect in an enzyme. Inborn errors of metabolism usually manifest in the neonate or an infant but can even be first seen in an adult. Abnormalities in the production or metabolism of proteins, carbohydrates etc are usually due to a single gene defect... ?Introduction A genetic disorder is caused by a defect in a persons DNA. The defect can vary from a single gene mutation to an addition or deletion of the total chromosome or set of chromosomes....
The Roles of Amino Acid R-groups in the Structures and Functions of Transmembrane Ion Channels
4 pages (1000 words) , Research Paper
Only on StudentShare
...Amino Acid R-groups in the Structures and Functions of Transmembrane Ion Channels Introduction Amino acids refer to molecules with a group called amine. Each of these groups also contains two other groups known as carboxylic acid and the other side-chain connected to each of the amino acid. They comprise of elements like carbon, oxygen, nitrogen and hydrogen. All amino acids have two groups, i.e., carboxyl written as COOH and amino NH2. The examples of amino acids and their molecular weights: Alanine with a molecular weight of 71.09 and solubility of 16.65, glutamine having a molecular weight of 128.14 and solubility of 3.53, Asparagine with 115.09 molecular weight, Histidine having... The Roles of...
What is meant by conservative vs. non-conservative amino acid substitutions in a protein, what are the possible implications of each, including a possible impact upon nutrition?
1 pages (250 words) , Essay
Only on StudentShare
...amino acid substitutions in a protein, what are the possible implicationsof each, including a possible impact upon nutrition? Introduction A conservative amino acid substitution is where an amino acid is replaced with another amino acid that has a chemical structure like the one being replaced. It causes little or absolutely no change in shape or any other attribute of the protein in which the substitution is taking place. It may have no effect on the functioning of the protein. Since the substitution is not harmful to the DNA there are no changes to be observed. Impact on nutrition may not also be observed since the protein remains... Task: What is meant by conservative vs. non-conservative amino...
Describe the roles of amino acid R-groups to the transmembrane channels that allow passage of molecules and ions across lipid bilayers.
2 pages (500 words) , Essay
Only on StudentShare
...Amino Acids in Transport of Molecules and Ions The R group protein is identified as amino acid side chain, which holds an amine operational group thus producing a basic solution because of the additional amine group that remains un-neutralized by the acid group. The most common R-group protein is arginine while others that also contain a basic side chain include lysine and histidine (Berg, Tymoczko and Stryer 46). The nature of the amino acid R groups that read out the structure-function relations of peptides and proteins. The hydrophobic amino acids are met in the inside of proteins guarded against straight contact with water. On the other hand, the hydrophilic amino acids... Roles of R-Group Amino...
Toxicology
1 pages (250 words) , Research Paper
Only on StudentShare
...amino acid cysteine and hence in proteins containing cysteine has high affinity for methyl mercury forming a strong covalent bond. Methyl mercury can coordinate (bond) to more than one... ?Methylation is the addition of a methyl group to a substrate or the substitution of an atom or a group of atoms by a methyl group. A methyl group, CH3, is an alkyl group derived from methane, CH4, by lost of one hydrogen. The methylation process converts inorganic (metal) mercury, Hg, to methyl mercury, CH3Hg+. As a positively charged ion, methyl mercury combines with anions, such as chloride (Cl-), nitrate (NO3-), hydroxide (OH-), and sulphur containing anions, such as thio groups (SH). Indeed, the thio group on the...
Amino Acide
7 pages (1750 words) , Essay
Only on StudentShare
...amino acid protection in synthesizing small peptides: Production of peptides in known as "peptide synthesis", in organic chemistry. However, these organic compounds contain multiple amino acids which are bound together via "peptide" bonds; also known as amide bonds. Synthesis of peptides involves the coupling of carboxyl group or C-terminus of one amino acid to the amino group or N-terminus of another amino acid. In this process unintended reactions are expected, hence there is always a requirement of protecting groups. Chemical synthesis of peptide starts at the C-terminus of the peptide and ends at the N-terminus. The protecting groups are used to prevent polymerization of amino acids... Importance of...
Protein Diet in Athletes
2 pages (500 words) , Essay
Only on StudentShare
...amino acid on performance are debatable. Protein Dietary Requirement for Athletes Protein requirement in athletes depends on various factors including the type of athlete, body weight, total energy intake, training status, intensity and duration of exercise. The American College of Sports Medicine, the Dietitians of Canada... Protein Diet in Athletes Affiliation Protein Diet in Athletes Introduction Proteins serve various functions in the body including building and repairing of muscle and tissues, synthesis of red blood cells, hormones and enzymes as well as energy production. In highly physical activities such as athletics, the adequacy of Recommended Dietary Allowance (RDA) and the role of the amino ...
Genes
4 pages (1000 words) , Download 0 , Essay
Free
...amino acids on a given protein, that is, the genetic information on the DNA molecule provides the basis for the synthesis of proteins in a given organism. Starr and Taggart (2006) point out that all living organisms... ? About Genes About Genes DNA is the basic form in which instructions and information on the characteristics of any organism is stored in the cells. This information and instructions for the synthesis of the proteins is stored in DNA molecule in form of a sequence of nucleotides, including Adenine, Thymine, guanine and cytosine; commonly abbreviated as A, T, G and C respectively, in a given order. The sequence of these four nucleotide bases on a DNA molecule determine the sequence of amino ...
Translation of MRNA to Proteins
1 pages (250 words) , Essay
Only on StudentShare
...acid) site, where the aminoacyl-tRNA anticodon base combine with the mRNA codon ensuring the actual amino acid is included in the growing polypeptide chain. The second site is the P (polypeptide) site where the amino acid is moved from its TRNA to the growing chain of polypeptide. The third site is the E (exit) site where the empty TRNA stays before it is released back to the cytoplasm to combine with another amino acid and the process is repeated (Clancy and William, 2008). The next phase in the translation process is the elongation phase. In this phase, the ribosome...
Cell Biology
2 pages (500 words) , Download 1 , Essay
Free
...amino acid sequence. would not 13. A mutation in a UAC to a UAG would / would not affect the amino acid sequence. would 14. A mutation in the 5’ untranslated sequence of an mRNA that changes a AAG to an AUG would / would not affect the amino acid sequence. would 15. Scientists think that the first forms of life were RNA based. What are the two characteristics of RNA that make this possible? RNA has the ability to act as both genes and enzymes. Furthermore, RNA can be transcribed into DNA, in reverse of the normal process of transcription.... 30 October 2006 In Eukaryotes, RNA polymerase I II makes RNAs that become mRNAs. RNA polymerase II 2. The start signal for RNA synthesis is the same / diff...
Bioinformatics assignment
4 pages (1000 words) , Assignment
Only on StudentShare
...amino acid sequence is codes for serotransferrin in humans while it forms part of the protein code for lactotransferrin in horse. This shows that the same peptide sequence codes for the same protein in different species. Task 3 (1... ?School of Health Science Techniques and Applications in Molecular Biology (PRINT)……………………………………….. YOUR ID………………………………………….. YOUR PROGRAMME (circle): Biol / BMS / HNC / other…………….............. Bioinformatics assignment – exploring proteins using bioinformatics tools. This completed proforma must be submitted via the coursework receipting office together with a completed receipt proforma. Please put ……….. as the member of staff who is to receive the work. Tasks 1-7 are...
Bioinformatics assignment
4 pages (1000 words) , Assignment
Only on StudentShare
...amino acid sequence is codes for serotransferrin in humans while it forms part of the protein code for lactotransferrin in horse. This shows that the same peptide sequence codes for the same protein in different species. Task 3 (1... School of Health Science Techniques and Applications in Molecular Biology (PRINT)……………………………………….. YOUR ID………………………………………….. YOURPROGRAMME (circle): Biol / BMS / HNC / other…………….............. Bioinformatics assignment – exploring proteins using bioinformatics tools. This completed proforma must be submitted via the coursework receipting office together with a completed receipt proforma. Please put ……….. as the member of staff who is to receive the work. Tasks 1-7 are relate...
"LOVE" Chapter 17 Questions
1 pages (250 words) , Research Paper
Only on StudentShare
...amino acids. The linear codon sequence and the linear amino acid have a 3-nucleotide to 1 amino acid correspondence. Question 6. The genetic code is redundant in the sense that some amino acids can be specified by more than one codon but Ambiguous in the sense that each codon specifies a particular amino acid and only that amino acid. Question 7.It just means that life appeared only once on Earth and was the basis of DNA into RNA. Question8. Transcription is the process in which DNA is converted into a complementary RNA and Just Before transcription, the splicing... and Chapter 17 Questions Question RNA is different from DNA in the sense that the 5 carbon sugar is ribose not deoxyribose; the nitrogen...
Protein
2 pages (500 words) , Essay
Only on StudentShare
...amino acid degradation that is used in the body. Alanine is the product of transamination of pyruvate that happens in the muscles. From the muscles, the alanine is absorbed in the liver where the process of transamination occurs. The process occurs in the presence of alpha-ketoglutarate. This cycle generates pyruvate which enters the gluconeogenesis cycle and glutamate which enters the urea cycle. The enzyme which is required for these processes to occur is alanine amino transferase. Q... Protein Q Describe the alanine-glucose cycle. The alanine-glucose cycle is responsible for the exchange of alanine molecule between skeletal muscles and liver. Like glutamine, alanine is a very important resultant of...
Intellectual Property
3 pages (750 words) , Essay
Only on StudentShare
...amino acid for use in recording a required number of motifs and in ELBL. This is a seven step method consisting of (a) obtaining a peptide amino acid sequence from a given organism; (b) locating a starter amino acid; (c) examining the starter amino acid t determine the number of charged amino acids which have an opposite polarity; (d) Continuing the method at step if the number of charged amino acid with opposite polarities are more; (e) examining the said amino acids and determining which amino acids have a given polarity; (f) if the said amino... Intellectual Property Rights Pharmaceutical Composition for Treating Diabetes This invention was filed in the U.S inAugust 2008 by Zhou Yinjun, Jiand...
Cell Biology Essay
2 pages (500 words) , Essay
Only on StudentShare
...amino acid _____. 12. sequence c) On heating, a protein will become _____. 4. denatured d) On removal of urea, an unfolded protein can become _____. 11. renatured e) The final folded conformation adopted by a protein is that of its ____ energy. 8. lowest f) The sheet are the most common folding motifs because they are formedhelix and the by hydrogen bonds between atoms of the _____. 10... . polypeptide backbone g) Any substance that will bind to a protein is known as its _____. 13. side chains h) Enzymes bind substrates at their _______. 1. active site i) Enzymes bind regulators at their ______. 2. allosteric site j) Enzymes catalyze chemical reactions by providing...
Biochemistry Assignment
1 pages (250 words) , Assignment
Only on StudentShare
...acid (glutamate) act as an excitatory neurotransmitter Amino acid group contains the universal excitatory transmitter called Glutamate.Glutamate acid is the most dominant excitatory transmitter in the central nervous system. Neurons from glucose are responsible for the synthesis of glutamate. It plays its role by opening sodium Na and potassium K channels. Upon its release, glutamate is conveyed from the synaptic cleft either to adjacent neurons or into the nearby glial cells. Those neurons that produce glutamate at their Synaptics are are called glutamatergic. The principal effect of glutamate in the central nervous system is the fast excitation through direct... Biochemistry Assignment How glutamic...
Learning Experiences 5 (Personal Training)
1 pages (250 words) , Essay
Only on StudentShare
...acid) 400 mg 100 Vitamin B-12 (cyanocobalamine) 100 mcg 1667 Biotin 300 mcg 100 Pantothenic Acid (calcium D-pantothenate) 50 mg 500 Calcium (citrate) 100 mg 10 Iron (amino acid chelate) 10 mg 56 Iodine (potassium iodide) 150 mcg 100 Magnesium (magnesium aspiartate) 50 mg 13 Zinc (amino acid chelate) 15 mg 100 Selenium (amino acid complex) 50 mg 71 Copper (amino acid chelate) 2 mg 100 Manganese (amino acid chelate) 5 mg 250 Chromium (amino acid chelate) 150 mcg 125 Molybdenum (amino acid) 50 mg 1 Potassium (asparate) 50 mg - Citrus Bioflavonoids 50 mg - Betaine HCL 50 mg - Choline Biatrate 50 mg - Inosital 50 mg - Boron (amino... MULTIVITAMIN FORMULAS ID/REGISTRATION DETAILS SCHOOL/AFFILIATION...
Checkpoint kinases (CHK2)
2 pages (500 words) , Lab Report
Only on StudentShare
...amino acid that is encoded. The amino acid is at position 347. The Transcript has several SNPs but I selected T/C (rs1805129).The figure below shows variations that exist in the CHK 2 gene. Figure 1.Variations that exist in the CHK 2 gene Population Genetics Basing on the figure below, it is observed that the ancestral nucleotide is T and the new nucleotide is C. Also in the figure we can see the way SNP is distributed in the different populations. In the general population, it is evident that T has 96% while C has 4... Results Variations in the gene This gene has 27 transcripts (splice variants).In this case, I considered Synonymous variant, a sequence variant wherethere is no resulting change to the...
Thalassaemia
2 pages (500 words) , Lab Report
Only on StudentShare
...amino acids and anionic amino acids. The pH of the solution in which amino acids are dissolved mostly determine their ionic... Thassaleamia Lab Report Questions Samples Sample A: Polycythaemia vera Sample B: β-thalassaemia trait Sample C: Leukemia SampleD: β-thalassaemia homozygote Sample E: β-thalassaemia trait 2. Causes of Thalassaemia Thalassaemia is a blood disorder with inherited autosomal recessive features that affect the amount and nature of haemoglobin produced by a person. Most of the syndromes of α-thalassaemia result from gene deletions or gene mutations in one or more of the four α-globin gene copies. The syndromes of β-thalassaemia result from nucleotide deletions or substitutions in sets of...
Caveolin protein
1 pages (250 words) , Essay
Only on StudentShare
...amino acid length of CAV-1 is 178 (UniProtKB). As a 21- to 24-kDa protein, CAV-1 is composed of 16 amino acids longer than CAV-2 and additional N-terminal 27 amino acids as compared to CAV-3 (Fielding 177). CAV-1 has two variants known as CAV-1α (contains amino acid tyrosin 14) and CAV-1β (does not contain the “first 31 amino acid present in CAV 1α) (Mercier, Jasmin and Lisanti 18). Both CAV-1α and 1β can be found in the lungs whereas CAV-1β can be found in the epithelial cells (Yuan, Garcia... ID Number & Caveolin Protein As a good example of scaffolding protein, the caveolin is considered as the principal marker of the caveolae (Gussak and Antezelevitch 234). Since the caveolin serve as the caveolae...
Tea and L-Theanine
1 pages (250 words) , Essay
Only on StudentShare
...amino acid (theanine) triggers alpha waves in the brain. Alpha waves are associated with relaxation. However, Miller (2013) asserts that green tea also contain caffeine and those looking for relaxation should thus go for decaffeinated tea. L-theanine (γ-glutamylethylamide) is a type of amino acid distinct to tea plant. It increases dopamine and serotonin production in the brain. It boosts alpha-brain wave activity, which in turn induces relaxation (Thorne Research Inc., 2005). Theanine competitively... Tea and L-Theanine Tea and L-Theanine Green tea is a strong antioxidant that can also bring relaxation effectto its users because its theanine content. According to Miller (2013), studies show that amino...
How proteins in the diet are disassembled and then reassembled to form useful proteins in the body
4 pages (1000 words) , Download 2 , Essay
...amino acids by various proteolytic enzymes. These enzymes are dipeptidases, carboxypeptidase and aminopeptidase. Since... ?How proteins in the diet are disassembled and then reassembled to form useful proteins in the body? Proteins are important constituent of our diet. Proteins can be obtained from meat, mutton, eggs, fish, cereals and many other things. Proteins in our body are first disassembled into its basic units by digestion. Disassembly of proteins is also called as proteolysis. First of all, proteins in our food are broken down into smaller units called as peptide chains. Many digestive enzymes include pepsin, trypsin, elastase and chymotrypsin. These peptides are further converted into amino...
Maple Syrup Urine Disease
2 pages (500 words) , Essay
Only on StudentShare
...amino acid metabolism Maple syrup urine disease is an autosomal recessive inborn error due to defective activity of branched-chain -ketoacid dehydrogenase complex (Fauci et al, 2008: 2472; Leucine mildly to moderately elevated). This enzyme participates in the metabolism of branched-chain amino acids (BCAAs) namely leucine, isoleucine and valine. These amino acids have carbon arrangements not synthesized naturally by humans thus these are included in the list of essential amino acids. Because they are not fully metabolized, this leads to accumulation of these amino acids and their corresponding -ketoacids (Laygo, 2007:28). Branched-chain -ketoacid... MAPLE SYRUP URINE DISEASE An inherited disorder of...
Protein supplements for enhancing sport performance
4 pages (1000 words) , Essay
Only on StudentShare
...amino acids Caffeine Creatine Alkalinizing agents CNS-acting compounds Glucosamine If taken in the right amounts, these supplements can help enhance the performance of athletes. However, this paper will narrow down to protein and amino acid supplements and their benefits. Many athletes use protein and amino acids supplements for the intended purpose of muscle growth, repair, and recovery of energy. They believe that a substantial intake of protein supplements... ?(Insert of Protein Supplements for Enhancing Sports Performance Athletes and sports personalities arealways on a quest to better their performance in the field or track every time they are in action. This performance is not only enhanced by the...
Biology 206 U3IP
3 pages (750 words) , Research Paper
Only on StudentShare
...amino acid sequence): Methionine+glycine + Asparagine+ histidine+ arginine+ STOP Mutated gene sequence one: 3’-T A C G C T T T A G T A G C C A T T-5' Transcription (base sequence of RNA): A U GC G A A A U C A U C G G U A A Translation (amino acid sequence): Methionine + arginine+ asparagine + histidine + arginine + STOP Mutated gene sequence two: 3’-T A A C C T T T A C T A G G C A C T-5’ Transcription (base sequence of RNA): A U U G G A A A U G A U C C G U G A Translation (amino acid sequence): Isoleucine+ glycine + asparagine... Questions Response Part I Original DNA Strand: 3’-T A C C C T T T A G T A G C C A C T-5’ Transcription (base sequence of RNA): A U G G G A A A U C A U C G G U G A Translation...
Assignment-Synthesis of a Protein.
2 pages (500 words) , Download 1 , Lab Report
...Amino acid sequence: Serine (S)/ Serine (S)/ Leucine (L)/ Leucine (L... Sequence A: TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT DNA: TCT/TCC/CTC/CTA/AAC/GTT/CAA/CCG/GTT/CTT/AAT/CCG/CCG/CCA/GGG/CCC/CGC/CCC/TCA/GAA/GTT/GGT mRNA: UCU/UCC/CUC/CUA/AAC/GUU/CAA/CCG/GUU/CUU/AAU/CCG/CCG/CCA/GGG/CCC/CGC/CCC/UCA/GAA/GUU/GGU 66 nucleotides 1 UCUUCCCUCC UAAACGUUCA ACCGGUUCUU AAUCCGCCGC CAGGGCCCCG 51 CCCCUCAGAA GUUGGU Note: The numbers 1 and 51 represent the nucleotide positions. Example, at position 51, the nucleotide base is C or Cytosine When codons 24 to 66, including codons 66 are removed, the sequence reads, UCUUCCCUCCUAAACGUUCAACC UCU/ UCC/ CUC/ CUA/ AAC/ GUU/ CAA/ CC Amino a...
Tranexamic Acid
8 pages (2000 words) , Essay
Only on StudentShare
...acid: Literature Review Tranexamic acid is a common hemostat used to arrest bleeding either during or after surgery and in other medical conditions that lead to blood loss. Tranexamic acid competitively inhibits the activation of plasminogen to plasmin thus preventing plasmin from degrading fibrin. This synthetic antifibrinolytic agent is derived from amino acid lysine. This paper examines various print and online literatures that provide information on the use of tranexamic acid. Literature on the use of tranexamic acid in orthopedic surgery and other Hemorrhagic conditions Guatam, Katyal, Yamin, and Singh argue... that tranexamic acid greatly decreases bleeding after...
Chemical equations, enthalpy changes and chemical equilibrium, acid, base and pH, and chemical reactions, chirality, simple organic functional groups and their reactions
3 pages (750 words) , Assignment
Only on StudentShare
...amino acids and sugars are natural chiral molecules produced in both animals and plants and beyond that, we can tell that the compound is indeed Amino acid since amino acids not sugars are used to treat Parkinson’s Disease. Ligand binding will mostly be either ionic or hydrogen bonds. However, at times, the intermolecular forces of the van der waals... Lecturer “Organic Chemistry” (a)  Compound A, shown in Figure is a biologically important molecule that is produced naturally by many plants and animals. It is also used as a treatment for Parkinson’s disease. This molecule contains a chiral carbon atom. Figure 1 Compound A. 1. Explain what the terms chiral atom and chiral molecule mean. Chiral atom is a...
Article Review(Mirror Molecules)
5 pages (1250 words) , Essay
Only on StudentShare
...amino acids as the rule in the general make-up of protein in all living organisms. The new discoveries brought about by the most unlikely occurrences have challenged our understanding of right-handed amino acids and their role in the biological composition of some species, and most importantly, of the human physiology. As the building blocks of protein, left-handed amino acids... ? Section: of Publication: Scientific American Publication: May, of Article: Mirror Molecules Page Numbers of Article: 78-81 Name of the Author: Sarah Everts Synopsis of the Article The article “Mirror Molecules” by Sarah Everts discusses the recent developments in the scientific understanding of the dominance of left-handed...
Acid Rain
6 pages (1500 words) , Research Paper
Only on StudentShare
...amino acids were slightly affected among species and only glutamate sharply decreased in AR-exposed Xanthoria (Kováčik et al) Another major disadvantage of acid rain is its ability to destroy metallic structures like, rails buildings etc. All the acids have the ability to react with metals easily. In chemistry, metals are arranged in the first and second group of the periodic table. In other words, metals have only one or two electrons in its valence shell. It should be remembered that when the number of electrons in the outermost or valance shell decreases, the ability of the element to participate in chemical reactions increases. Thus metals are highly reactive to acids like... Acid Rain “Acid rain...
GENETICS AND GENE MUTATION
3 pages (750 words) , Coursework
Only on StudentShare
...amino acid sequence): MET (START)-GLY-ASN-HIS-ARG-STOP Mutated gene sequence one: 3’-T A C G C T T T A G T A G C C A T T-5' Transcription (base sequence of RNA): AUG-CGA-AAU-CAU-CGG-UAA Translation (amino acid sequence): MET (START)-ARG-ASN-HIS-ARG-STOP Mutated gene sequence two: 3’-T A A C C T T T A C T A G G C A C T-5’ Transcription (base sequence of RNA): AUU-GGA-AAU-GAU-CCG-UGA Translation (amino acid sequence): ILE-GLY-ASN-ASP-PRO-STOP What is the significance of the first and last codons of an mRNA transcript? Explanation: The first... Questions Response Part I Original DNA Strand: 3’-T A C C C T T T A G T A G C C A C T-5’ Transcription (base sequence of RNA): AUG-GGA-AAU-CAU-CGG-UGA Translation...
Genetics
3 pages (750 words) , Assignment
Only on StudentShare
...amino acid sequence): MET (START)-GLY-ASN-HIS-ARG-STOP Mutated gene sequence one: 3’-T A C G C T T T A G T A G C C A T T-5 Transcription (base sequence of RNA): AUG-CGA-AAU-CAU-CGG-UAA Translation (amino acid sequence): MET (START)-ARG-ASN-HIS-ARG-STOP Mutated gene sequence two: 3’-T A A C C T T T A C T A G G C A C T-5’ Transcription (base sequence of RNA): AUU-GGA-AAU-GAU-CCG-UGA Translation (amino acid sequence): ILE-GLY-ASN-ASP-PRO-STOP What is the significance of the first and last codons of an mRNA transcript? Explanation... Questions Response Part I Original DNA Strand: 3’-T A C C C T T T A G T A G C C A C T-5’ Transcription (base sequence of RNA): AUG-GGA-AAU-CAU-CGG-UGA Translation (ami...
Critical Annotated Bibliography Tranexamic Acid
10 pages (2500 words) , Essay
Only on StudentShare
...acid, which is a synthetic derivative of amino acid lysine, is an effective antifibrinolytic agent. The acid is may reversibly block lysine-binding sites on the plasminogen molecules, thus hinder the formation of plasmin. Other researchers have showed increased use of tranexamic acid in orthopaedic surgery due to its safety, efficacy and low cost. The research was conducted in a tertiary health care facility after obtaining approval from the hospital heath ethics committee with informal consent taken from patients involved... ? Critical Annotated Bibliography Tranexamic Acid Guatam, P. L., Katyal, S., Yamin , M., & Singh, A. . Effects of tranexamic acid on blood loss and transfusion requirement in total...
Biology
2 pages (500 words) , Download 1 , Essay
...Amino acids are a brand of organic compounds that contain both the amino and the carboxyl groups. Close to 20 of these acids act as the building blocks of proteins, which exist as a linear sequence of amino acids, joined together by peptide bonds, between the carboxyl and amino groups of adjacent amino acid subunits. The carboxyl group of one amino acid is linked to the amino group of the next, and so on. This chainlike molecule, which may range from 50 to several hundred amino acid subunits, is called a polypeptide. A protein may be made up of a solitary polypeptide chain or several such chains tied together by molecular bonds. Each protein is formed in accordance with a set of instructions...
The Hydrogen Bond
2 pages (500 words) , Essay
Only on StudentShare
...amino acid side chains ,atoms on amino acid side chains and water molecules at the protein surface Regions in a protein molecule in which amino acids are arranged into specific, regular spiral or folded structures are called secondary structure. There are two forms of secondary structure, the alpha helix and the beta pleated sheet. Each of these structures is stabilized by hydrogen bonds between atoms of the amino acid backbones which are the same as atoms involved in peptide bond formation. Although individual hydrogen bonds are weak, the combination of many hydrogen bonds makes... The Hydrogen Bond is one of the most important components of existence and vitality. It occurs in many biological...
Sickle Cell Anemia
6 pages (1500 words) , Download 1 , Essay
...amino acids which in turn form chains and links to form proteins. These sequences of amino acids are very important because they are responsible for the shape, structure and characteristics of a protein. Any change in this sequence is called a mutation and the effects could be dreadful. Change in this sequence could cause the characteristics of a protein to change completely. Mutation is basically the spontaneous change... 25th December SICKLE CELL ANEMIA Sickle cell anemia is a disease that is categorized at the molecular level. It is an inherited disease which can be passed on from generation to generation from both the parents. The term sickle cell comes from the sickle shape or the crescent type...
Recent biotechnological approaches that have been used to enhance the yield and diversity of amino acids, vitamins, antibiotics
8 pages (2000 words) , Essay
Only on StudentShare
...amino acids and growth factors etc... ? Recent biotechnological advancements The process of production and enrichment of biological materials for the welfare of the mankind from the naturally available sources is the main task of biotechnology. Biotechnology combines the life science with the technology to derive many useful products. The knowledge of science mixed with the engineering concepts lead to the production of biotechnological products. Biotechnology is a part of our life. In every day activity we use many biotechnological products such as bread, curd, yoghurt, cheese, rice cakes, wine, beer etc., Nowadays we can see many products being advertised as being enriched with vitamins, minerals,...
The process of protein synthesis
1 pages (250 words) , Essay
Only on StudentShare
...amino acid (AA) is joined to the correct tRNA. In Initiation, the small sub unit of ribosome binding to 5 end of mRNA with the help of initiation factors (IF). The other proteins assist the process. In Elongation, the next aminoacyl tRNA (charged tRNA) linebinds to the ribosome along with GTP and an elongation factor. Termination of polypeptide happens when the A site of the ribosome faces... Protein Synthesis Proteins are manufactured or built up in the cells. The process in which cells build up proteins is called protein synthesis. Genescontrol the character of organisms through protein synthesis. It involves two steps—transcription and translation. Transcription The transcription of mRNA from a DN...
5step Approach to Biomedical Science Research
2 pages (500 words) , Essay
Only on StudentShare
...amino acid sequences of mammalian and malarial SERCAs, and found that the leu263 residue is unique along with few more amino acid. After identification, different mutant were constructed to determine the affinity of arteminsins towards these mutated forms to establish its role of each amino acid towards arteminsins sensitivity. Carried Out Experiments and Obtained Data: To determine the role of leu263 and other amino... 5-step Approach to Biomedical Science Research Identified a & Proposed a Hypothesis Arteminsims from sweet wormwood are known to be the important class of antimalarial drugs. Artemisinin-containing therapies have increased, but the mechanism of action of the sesquiterpene lactone...
Human Anatomy
3 pages (750 words) , Term Paper
Only on StudentShare
...Amino Acid Metabolism The protein - energy relationship is a significant parameter that adjusts itself with the other physiologic conditions during phenomenon of shrinkage. Amino acids required as essential substrates for protein synthesis... Human Anatomy The fact that Alice shrank was fantasy; but it is quite intriguing to know, how that ten year old girl shrinking to almost one-hundredth of her usual size did manage to carry out the usual bodily functions in a perfect way. Lewis Carroll, however, didn't think of that - though he did spin a fascinating web of fiction that compelled millions to hold their beating breath till the end of a very interesting story. In order to figure out the nature of...
Folate or Folic Acid
21 pages (5250 words) , Essay
Only on StudentShare
...amino acid. What foods provide folate Leafy green vegetables (like spinach and turnip greens), fruits (like citrus fruits and juices), and dried beans and peas are all natural sources of folate. In 1996, the Food and Drug Administration (FDA) published regulations requiring the addition of folic acid to enriched breads, cereals, flours, corn meals, pastas, rice, and other grain products. Since cereals and grains... Folic Acid Folate or Folic Acid Overview As many as 20% of older people may be deficient in vitamin B12, also know as cobalamin. It was the most recent vitamin to be discovered and in the late 1940s, it was identified as the essential nutrient that caused pernicious anemia, a potentially...
Turkey make people sleepy
4 pages (1000 words) , Essay
Only on StudentShare
...amino acid contents that tend to make people tired and sleepy. However, this has also contributed to a controversy as other animals’ products and meat contains some level of these substances as well. “This is based on a little right information, but just misapplies and misunderstood”, this is what Fiona Martinez – a professor of molecular nutrition from Minnesota University had to say. Turkey traditionally has been regarded as the main meal in the thanksgiving ceremonies. Funnily, it has been observed... Part I Turkey makes people sleepy Sometimes the stories we tell ourselves and others may be true. Myths are one of such stories we make about things which could be true or false. Turkey has been...
BIOCHEMISTRY ASSIGNMNET
11 pages (2750 words) , Scholarship Essay
Only on StudentShare
...amino acid. Draw the structure of the amidated amino acid residue. (5) The following reagents act on this peptide. Write out the products for each treatment, using the one-letter amino acid abbreviations. (6) a. Trypsin GAK---K---IYPR---VSACMIHGGAVIAIDMDGTDA b. Dansylchloride (first products) GAK---KIYPRVSACMIHGGAVIAIDMDGTDA c. Cyanogen bromide. GAKKIYPRVSACM---IHGGAVIAIDM---DGTDA Peptide Z is an inactive precursor. It is converted to the active peptide by hydrolysis with chymotrypsin. The larger product of the hydrolysis... FROM the questions are incomplete next time, kindly upload a proper copy question b.Calculate the theoretical net charge on the amidated peptide at pH 7.5. Show your...
Essay
1 pages (250 words) , Essay
Only on StudentShare
...amino acid chart text as a reference (Chapter Three) "translate" each triplet of bases with tRNA into a chain of amino acids. Triplet code Amino acid AAA AAG Lysine AAC AAU asparagines ACA ACC threonine ACG ACU AGA AGG Arginine AGC AGU Serine AUA AUG methionine AUC AUU Isoleucine CAA CAG glutamine CAC CAU histidine CCA CCC proline CGA CGC arginine CGG CGU CUA CAC CUG CUU Leucine c. In the original DNA sequence, remove the first Guanine (G), and retranslate the sequence into the revised chain of amino acids d. To what degree does this impact the amino... PART A: Microevolution and Natural Selection (see text example of peppered...
1 - 50 results of 500 items