Synthetic Protein Expression - Essay Example

Protein Expression Given: synthetic protein MRQRIAQLRQRIRRLRRKSAQLRQRIAQLCQRIAQLRQRI Objective To construct and synthesize the gene required to express the above synthetic protein 2. Insert gene sequence to pCR Blunt II TOPO Vector 3. To express the synthetic protein in appropriate expression vector Steps: 1. The nucleotide or DNA sequence that will code for the synthetic protein was determined through reverse translation using ExPASy (Expert Protein Analysis System) proteomics server of the Swiss Institute of Bioinformatics (http://www.expasy.ch/tools/ #translate) and the Sequence Manipulation Suite (Stothard, 2000) (http://www.bioinformatics.org/sms2/ rev_trans.html). The most possible sequence given was based on codon usage database generated using all the E. coli coding sequences in GenBank. 5’-atgcgccagcgcattgcgcagctgcgccagcgcattcgccgcctgcgccgcaaaagcgcgcagctgcgccagcgcattgcgcagctgtgc cagcgcattgcgcagctgcgccagcgcatt-3’ The presence of repeats, palindromic, sequences were checked by EMBOSS Explore (http://emboss.bioinformatics.nl/). Due to presence of a high degree of palindromic sequences changes were made in the 3rd codons for R and A, and the 1st codon for L based on the second priority codon preference. The changes reduced the chances of self-annealing and formation of secondary structures. The new gene sequence was thus: 5’- atgcgtcagcgtattgcccagttgcgtcagcgtattcgtcgtttgcgtcgtaaaagcgcccagttgcgtcagcgtattgcccagttgtg ccagcgtattgcccagttgcgtcagcgtatt -3’ This sequence was resubmitted to ExPASy for translation to verify if the original desired protein sequence was retained. The next step was to choose the restriction enzymes for cutting out the complete gene after it has been cloned to the TOPO vector. NdeI, which cleaves the sequence CA/TATG was chosen for the 5’ end while BPu1102 which cuts GC/TGAGC was selected for the 3’ end. Both restriction enzymes do not have restriction sites in the chosen vector (but are present in the expression vector which will be used for protein expression later). GCGC nucleotides are added before and after the NdeI and BPu1102 sites respectively to act as primer initiation sites for PCR of the final gene sequence which is the following: 5’-gcgccatatgatgcgtcagcgtattgcccagttgcgtcagcgtattcgtcgtttgcgtcgtaaaagcgcccagttgcgtcagcgtattgcccagt tgtgccagcgtattgcccagttgcgtcagcgtattgctgagcgcgc-3’ (underlined nucleotides are for spacer and restriction sites). These sequence was the one used for inserting into the TOPO vector for further amplification. 2. The PCR-based methods for gene synthesis normally require a DNA template, which is not available for designed peptides, for error-free amplification. To reduce error, nucleotide stretches of the optimized gene sequences are synthesized and ligated to complementary sequences followed by PCR amplification (Tsuchiya, Morioka, Shirai, Yoshida, & Inumaru, 2006) (Young & Dong, 2004). These procedures result in different gene fragments that have errors in the sequences. Further cloning, purification and sequencing for the desired gene sequence is expensive and time-consuming. In this study, the gene will be synthesized using circular assembly amplification, a new technique in gene synthesis that removes error sequences and increases the probability of getting accurate sequences (Bang & Church, 2008). Here, a mixture of short complementary oligonucleotides (~ 50bp), that are designed with overlaps to allow complementary coupling or annealing, generates circular DNA. This is followed by exonuclease treatment to remove linear DNA, then endonuclease to remove mismatched circular DNA. Through these steps, only the DNA with the correct sequence is retained for further PCR amplification. The following strands of complementary stretches of nucleotides will be synthesized. Each strand has an overhang to allow ligation of the complementary bases: 1a 5’-GCGCCATATGATGCGTCAGCGTATTGCCCAGTTGCGTCAGCGTATT-3’ 1b 5’-ACGAATACGCTGACGCAACTGGGCAATACGCTGACGCATCATATGGCGC-3’ 2a 5’-CGTCGTTTGCGTCGTAAAAGCGCCCAGTTGCGTCAGCGTATTG-3’ 2b 5’-TGGGCAATACGCTGACGCAACTGGGCGCTTTTACGACGCAAACG-3’ 3a 5’-CCCAGTTGTGCCAGCGTATTGCCCAGTTGCGTCAGCGTATTGCTGAGCGCGC-3’ 3b 5’-GCGCGCTCAGCAATACGCTGACGCAACTGGGCAATACGCTGGCACAAC-3’ The oligonucleotides will be mixed and allowed to anneal and ligate at high stringency (70°C). This corresponds to the first tier of selection. The second tier of selection involves the removal of the non-circular DNA by the use of exonuclease. Finally, mismatched DNA is removed by the action of endonuclease (3rd tier). After the third step, the DNA products can be visualized and purified from agarose gel. This product can be sent for sequencing before further PCR to validate if the sequence is correct. (This is optional and one can proceed to PCR immediately). PCR amplification is carried out under strict parameters with annealing temperature no lower than 65°C and the use of high-fidelity Taq polymerase to further ensure purity of products. The following primers are designed which carry the restriction sites (undercored) and extra bases Forward primer: 5’-GCGCCATATGATGCGTCAGCGTATTGCC-3’ (28bases, 57% GC, Tm at 50 mM salt, 0.2uM primer concentration = 76.14 °C) Reverse primer: 5’-GCGCGCTCAGCAATACGCTGACGCA-3’ (25 bases, 64% GC, Tm at 50 mM salt, 0.2uM primer concentration = 77.14 °C). PCR products are visualized by agarose gel electrophoresis. Product size is approximately 140 bp. The PCR product is excised from the gel and purified using commercial gel purification kits. 3. Purified PCR product will be inserted into the pCR Blunt II TOPO vector (Invitrogen Life Technologies). This vector is for easy cloning of blunt-end PCR products. Kanamycin resistance will be the selectable marker. After ligation, the vector carrying the insert will be transformed by heat shock or electroporation into E. coli competent strains DH5α or DH10β. After selection for Kanamycin antibiotic resistance, colony PCR using SP6 and T7 primers will check successful insertion. Positive colonies will be for sequenced. The gene with the correct sequence will be cut out using NdeI and Bpu1102. 4. The gene (after restriction or cutting with NdeI and Bpu1102) will be inserted into pET14b expression vector (Novagen). The vector has restriction sites for NdeI and Bpu1102. Before ligation, pET14b must be digested with NdeI and Bpu1102. The insertion direction of the gene will be controlled by these restriction sites. pET14b also has a His-Tag at the N-terminal site and a thrombin moiety where thrombinase can act on, and the ampicillin resistance gene. The vector will be transformed into competent cells BL21(DE3)pLysS (Novagen), which is an expression system host. Selection for positive clones will be through ampicillin resistance. Positive colonies will be cultured and the desired protein expressed by auto-induction. 5. Bacterial cells will be concentrated in pellets through centrifugation. Soluble and insoluble fractions will be collected. Protein expression is detected by SDS-PAGE or Western bolt using Hisprobe-HRP. After this detection step, the protein will be purified from the fraction where it is most concentrated (normally, in the soluble fraction). Purification will be by affinity chromatography of the histidine-tagged protein. After purification, further characterization may be carried out as follows: protein concentration (Bradford assay), mass spectra, structural analysis, and specific bioassays (to check if protein toxicity or bioactivity is present). References Bang, D, & Church, GM 2008, ‘Gene synthesis by circular assembly amplification’, Nature Methods,vol. 5, no. 1, pp. 37-39. Novagen n.d., pET System Manual , 11th edn, Novagen, United Kingdom. Stothard, P 2000. ‘The Sequence Manipulation Suite: JavaScript programs for analyzing and formatting protein and DNA sequences’, Biotechniques, vol.28 ,pp. 1102-1104. Tsuchiya, Y, Morioka, K, Shirai, J, Yoshida, K, & Inumaru, S 2006 ‘Comparison of artificial synthesis methods of gene’, Nucleic Acids Symposium Series, no. 50, pp. 275-276. Young, L & Dong, Q 2004, ‘Two-step total gene synthesis method’, Nucleic Acids Research, vol.32, no.7, p.e59. Read More