Stress Conditions - Essay Example

www.academia-research.com Sumanta Sanyal d: 03/03/07 Endurance Thresholds to Various Stress Factors of Saccharomyces cerevisiae Introduction This paper is put together in preparation of a project that aims to investigate stress conditions under which the (heat shock protein) hsp26 gene is switched on by using a simple -galactosidase assay that changes colour to demonstrate activity. The project will use Saccharomyces cerevisiae, the common baker's yeast, and will seek to determine the various endurance thresholds this eukaryotic organism has for various stress conditions such as heat, cold, osmotic pressure, exposure to ultra violet radiation, exposure to heavy metals and changes in pH levels. Saccharomyces cerevisiae is a yeast used in making wine, bread and beer and is considered a very important organism in the context of food production. Saccharomyces is a genus in the kingdom of 'fungi'. The name means 'sugar fungi' (Saccharomyces, Wikipedia Online, 2007). The genus includes many other types of yeast important to food production. The taxonomic structure of Saccharomyces cerevisiae is as follows: Cellular organism - Eukaryota Group - Fungi/Metazoa Kingdom - Fungi Phylum - Ascomycota Subphylum - Saccharomycotina Class - Saccharomycetes Order - Saccharomycetales Family - Saccharomycetaceae Genus - Saccharomyces Species - Saccharomyces cerevisiae (Taxonomy ID: 285006, NCBI, 2007) Stress Conditions in S. cerevisiae S. cerevisiae (Baker's yeast) is subjected to various environmental stresses during its propagation and industrial application. Yeast being prepared for the baker's facilities is subjected to many such stresses as freezing, frozen storage and thawing of bread dough. Besides this there are the usual stresses of fluctuations in nutrient supply, acidity levels, osmolarity and temperature and exposure to toxic substances like heavy metals and radiation (Schade et al, 2004). This often reduces the yeast's dough-leavening capabilities as well as other viable factors (Rodriguez-Vargas et al, 2002). The same is true when the yeast is applied to other food production techniques as wine-and beer-making. Thus, the negative effects of environmental stress on this species of yeast have great technological and economic impact (Rodriguez-Vargas et al, 2002). The organisms, through special stress response factors that act at the transcriptional levels, either induce or repress a set of genes known as the general or environmental or common stress response (ESR) (Schade et al, 2004). Genome wide transcriptional profiling has revealed that 10% of the entire genome is induced or repressed in this stress response (Schade et al, 2004). The induced genes usually are involved in cellular functions such as protein folding and degradation, transport and carbohydrate metabolism while the repressed genes are associated with cell growth-related processes that are suppressed till more convenient circumstances evolve. Such related processes may be RNA metabolism, nucleotide biosynthesis, secretion and ribosomal performance (Schade et al, 2004). Stress Regulation in S. cerevisiae Cells of Saccharomyces cerevisiae handle a diverse range of stresses by mediation via a penta-nucleotide element called stress response element (STRE). This is quite in line with the 5-nucleotide heat shock regulatory element discussed later in the paper. STRE mediates in conjunction mainly with two transcriptional proteins Msn2p and Msn4p (Treger et al, 1998). Several genes, the induced ones that are also the ones that are instrumental in inactivating the ones that are repressed in the environmental stress response, responding to stress like heat shock, osmotic shock, post-diauxic shift growth and nitrogen starvation are induced to transcriptional activity by sequences containing STRE, especially the Msn2p/Msn4p/STRE pathway (Treger et al, 1998). There are also a few genes that are controlled by specific stress factorial pathways such as the heat shock factor (hsf)/heat shock element (hsp) pathway while there are others that are induced to transcriptional activity by both the pathways (Treger et al, 1998). However, in context of this paper, it is found that hsp26, a gene that figures largely in this project, is induced predominantly by the hsf/hse pathway (Treger et al, 1998). Hsp26 is activated by hsf1 and though there is evidence that it is evident in S. cerevisiae during the stagnation phase and during starvation periods (any stress may bring is about) and is notably absent during healthy growth period (Panadero et al, 2005). There is also evidence that more universal heat shock protein genes like hsp104 and hsp12 do participate in the general environmental response of S. cerevisiae even when the stress is unrelated to heat (Rodrigues-Pousada et al, 2005). The paper adopts a strategy which aims mainly at how hsp26 together with a suitable gene that encodes the stress-mediating enzyme -galactosidase can be included in a mutation analysis which shows how and if the gene, indicated by its co-initiated enzymatic response, is initiated in stress responses other than heat in the yeast. Heat Regulatory Elements Heat shock proteins (hsp) genes have been found in almost all cells examined so far (Amin et al, 1988). They are usually silent at normal growth temperatures but are expressed at very high levels at above-normal temperatures or in cells incumbent under other types of stress. The encoded proteins can be grouped into four classes - the hsp90 and hsp70 families, the GroEL-related hsps and the small hsps (including hsp26) which are up to 40kDa in size (Wotton et al, 1996). Research on these began with hsp gene types as Drosophila melanogaster hsp70 genes that encode a major heat regulatory protein of 70 kilodaltons (kDa). The hsp70 genes were introduced into cell types such as NIH3T3 cells, monkey COS cells, Xenopus oocytes, Drosophila cells and others (Amin et al, 1988). The genes were found to be expressed in a heat regulatory fashion in most cells. Specifically in the monkey cells and the Xenopus oocytes a certain region of 45 to 65 nucleotides upstream of the transcription start site of the hsp70 genes was found to be absolutely essential for the proper functioning of the heat regulatory mechanism in these two types of cells. A second region, in addition to the first one, was also found between -65 to -90 related nucleotides that was required for high heat regulatory activity in the Drosophila cells (Amin et al, 1988). Comparison of the -45 to -65 sequence of the hsp70 Drosophila genes with analogous sequences in other hsp genes enabled establishment of a heat shock consensus sequence - CNNGAANNTTCNNG - where N is any nucleotide (Amin et al, 1988). It must be emphasised that the consensus is found upstream of the gene transcriptional sequence. It has since been established that factors binding to this type of sequence are involved in transcriptional activity of hsp genes. Such factors were subsequently purified from Drosophila nuclear extracts (Amin et al, 1988). Nevertheless, it has also been established that this heat shock consensus sequence is not by itself functional as a sole heat shock regulatory binding site (Amin et al, 1988). There are other sites on the gene sequence that also assist the heat shock consensus in transcriptional activity. Amin et al, 1988, conducted a mutation analysis on D. melanogaster S3 cells by transfecting the cells with varying nucleotide combinations characteristic of the heat shock consensus sequence of the hsp70 gene of D. melanogaster. The principal analysis revealed two primary features of the heat shock regulatory elements that were found common among all - 1. A functional heat shock element has at least three GAA/TTC blocks. These blocks are separated from each other by no more than a one-block gap provided that the three GAA/TTC blocks were distributed across the entire elemental sequence with proper orientation and spacing. It was found that a two-block gap was not tolerated if the element sequence had only three GAA/TTC blocks. Elements with more than three GAA/TTC blocks could tolerate more than one block gaps provided at least three of the GAA/TTC blocks were separated by only one block gaps (Amin et al, 1988). 2. The second important feature revealed by the analysis was that heat shock elements had nucleotide sequences that were characterised by the GAA/TTC blocks positioned immediately downstream of two other selective nucleotides that participated heavily in the heat shock regulatory mechanism and that enhanced activity to a large extent (Amin et al, 1988). Such selective positioning of specific nucleotides was found to be repeated more than once in many elements (Amin et al, 1988). The most preferred duo of nucleotides that seemed to occupy such up stream positions from the GAA/TTC blocks were - TA, TC and GA (Amin et al, 1988). Summarily, the paper finds that heat shock regulatory elements have a characteristic sequential modularity that comprises of a 5-nucleotide periodicity produced by multiple GAA/TTC blocks arranged in alternating orientation at 2-nucleotide intervals. Amin et al, 1988, found that elements that were functionally capable had at least three GAA/TTC blocks. Secondly, heat shock regulatory elements had two important nucleotides, primarily TA, TC and GA, positioned immediately upstream of the GAA/TTC blocks. These two nucleotides were found to be definitively involved in promoting competence of the elements (Amin et al, 1988). The Hsp Elements Now the paper shall investigate hsp26 gene, derived from D. melanogaster, in the context of how heat shock regulatory elements may be structured within the sequential arrangement of a hsp gene. The hsp26 D. melanogaster gene has the following nucleotide sequence inclusive of the heat shock consensus sequence for that gene: GTTCTTTTGCGCTCTTCTAGAAACTTCGGCTCTCTCA (Amin et al, 1988) The entire sequence ends at the -512 nucleotide point on the hsp26 gene length. As is immediately observable upon scrutinizing the sequence the 5-nucleotide periodicity is maintained with the GAA/TTC blocks found in the middle of the sequence (bold-face). It is notable that the fourth active block is separated from the three other active blocks by more than a one block gap, as is allowable when the shock sequence incorporates more than three such active blocks. The second 5-nucleotide block in boldface is the most conforming to the 3-nuclotide and 2-nucleotide sets ascertained as the most suitable for transcription activity by Amin et al, 1988, and are thus considered the most active. Sites like these are highly responsive to heat shock transcription factor (in this case hsf1) binding within the ambit of the entire heat shock consensus sequence. The more proximal heat shock regulatory element of the hsp26 D. melanogaster gene is sequenced as follows: CCTTTTTCTGTCCTTTCCGGACTCTTCTAGAAAAGCT (Amin et al, 1988) This has the last nucleotide at the -224 position of the hsp26 gene. The bold-faced letters constitute the element. The third block in bold-face contains the most conforming 5-nucloetide set and must be a very active site for transcription factor binding. Substitutions: Amin et al, 1988, point out that the most frequent substitution they encountered in their study for the GAA/TTC blocks were the GAG and CTC blocks. Since promoter activity was sustained they believe that these substitutions are viable. For the 2-nucleotide blocks, TA, TC and GA, that are usually found upstream of the 3-nucleotide ones the most frequent substitutions encountered were TG and CA. Amin et al, 1988, opine that these two substitutions are less favourable than the more frequent three 2-nucleotide blocks but, nevertheless, promoter activity was sustained and gene expression was at sufficiently high levels to suggest a successful mutation (Amin et al, 1988). Other Activating Sites: Amin et al, 1988, have cautiously determined the two principal recognition characteristics of heat shock regulatory elements as stated above because, through their analysis, they have observed that not only the heat shock consensus sequence but also other positions on the main sequence can assist in activation of the heat shock genes. Especially, the researchers find that the sequence at a full turn on the DNA helix from the consensus sequence can also considerably influence the activation mechanism (Amin et al, 1988). The Hsp26 Gene Aside from the TATA box the hsp26 gene has four other heat shock element sites upstream of its transcription start site. These are the proximal (-59) and distal (-340) heat shock elements (Lu et al, 1993). Two other heat shock element sites with repeated segments - proximal (-135 to -85) and distal (-347 to -341) - were also found (Lu et al, 1993). All these elements are required for efficient transcription of the gene (Lu et al, 1993). It is also found that, for D. melanogaster, a GAGA factor seems to maintain the element sites till the heat shock factor (hsf1) binds to them and initiates transcription (Lu et al, 1993). Incidence: The hsp26 gene is the major small heat shock protein gene found in S. cerevisiae (Wotton et al, 1996). It is conjectured that hsp26 functions in tandem with other stress response genes such as hsp104 because deletion studies have shown that there is no phenotype associated with the gene (Wotton et al, 1996). Sucrose gradient fractionation has shown that hsp26 is present in large complexes (Wotton et al, 1996). Function: In stressed cells protein folding is disrupted and there is danger of the misfolded proteins aggregating into mis-formed structures. The principal cellular strategy against this is to reactivate vital proteins from their aggregates (Cashikar et al, 2005). In S. cerevisiae hsp104p, with assistance from hsp70p and hsp40p, facilitates disaggregation of misfolded proteins and reactivates aggregated ones. The small heat shock proteins like hsp26p also function in this protein recovery and prevent aggregation in vitro though their in vivo role in this is more indeterminate (Cashikar et al, 2005). In addition, hsp26p is also involved single-strand break DNA repair, a role probably involving the one just mentioned. It is also found that the hsp26 protein becomes insoluble on subjection to sublethal heat shock but returns to solubility during cell recovery efforts only in the presence of the hsp104. In vitro, hsp104, together with other genes, transcribes proteins that aggregate a reporter protein luciferase but disaggregation of this protein is highly impaired in the absence of the hsp26 gene. The hsp26 protein also makes the protein aggregates more accessible to the larger heat shock proteins by assisting in the hsp104 mediated solubilisation of ployglutamine in yeast. It, together with the other small heat shock proteins, also shields other proteins from toxicity by sequestering the ployglutamine molecules even in the absence of the hsp104p (Cashikar et al, 2005). -Galactosidase The -galactosidase is an enzyme that can be expressed in S. cerevisiae by inducible transcription of the lacS gene from the extremely thermoacidophilic archaebacterium Sulfolobus solfataricus (Moracci et al, 1992). The enzyme encoded by the lacS gene, normally in Sulfolobus solfataricus, is extremely thermophilic (optimal activity temperature C), thermostable and highly resistant to protein denaturants and proteases (Moracci et al, 1992). The gene can be transcribed in S. cerevisiae by using the hsp26 gene from D. melanogaster. Under heat shock or other stress factors to be investigated later in the paper the heat shock regulatory element sites together with the heat shock consensus sequence, the transcription sequence and other essential parts of the hsp26 genetic sequence delineated later, transfected in suitable S. cerevisiae cell lines, can induce transcription of the lacS gene which can encode the enzyme. Colour plate assay for -galactosidase activity in S. cerevisiae can be subsequently used to determine whether the hsp26 protein is activated under stress conditions other than heat. This is the principal strategy of the project the paper seeks to elucidate and more of the finer points of this strategy shall be subsequently taken up as the paper progresses. The -galactosidase enzyme encoded in S. cerevisiae by the induced lacS gene derived from S. solfataricus is structurally and functionally very similar to the one encoded in the archaebacterium. It is identical in molecular mass, thermostability and thermophilicity to the native enzyme (Moracci et al, 1992). This fact is very useful to the purpose of the paper. This similarity stems from the biological fact that archaebacterium and eukaryotes, especially yeasts, carry many common genetic features. This is discussed in the immediately following section. Archaebacterium: Archaebacterium was accepted as a third kingdom in the late 1980s. The biological capabilities of these microorganisms that enable them to function and thrive in extreme environmental conditions have made them ideal candidates for studying their distinct molecular biology to better understand the evolutionary mechanisms of adaptation. For example, Sulfolobus solfataricus thrives in solfatarus at about C and pH3 (Moracci et al, 1992). As mentioned earlier, enzymes extracted from this bacterium are extremely thermophilic and resistant to high temperature, denaturing agents and proteases. Though the molecular basis for these exact features are still not fully known it has been ascertained from the molecular biology and genetic features, the incumbent DNA sequences, of these special creatures that they are highly similar to eubacteria and eukaryotes (Moracci et al, 1992). Prokaryotic features that are common in these archaebacterium are cell structure, the presence of Shine-Dalgarno-like sequences and the organisation of genes in transcriptional units (Moracci et al, 1992). This last is of special importance to the project this paper is an introduction to as it signifies that genes from arechaebacterium like Sulfolobus solfataricus can be activated in other organisms like the eukaryotic yeast S. cerevisiae through conventional transcriptional activity. Features that are common to both archaebacterium and eukaryotes are presence of introns in stable RNA genes, the sequence of translational factors, the existence of aphidicolin-sensitive DNA polymerases and the structure of RNA polymerases (Moracci et al, 1992). As also mentioned earlier, archaebacterium have been found to be more common to eukaryotes like yeasts than to eubacteria. This is in the sense that the archaebacterial RNA polymerase subunits show more sequential homology to eukaryotic genes that encode enzymes than to eubacterial ones. This also is of special convenience to the project as archaebacterial genes like lacS from S. solfataricus, when activated in the yeast S. cerevisiae by the promotion action of the hsp26 gene from D. melanogaster under thermal or other kind of stress, can easily be transcribed to synthesise the native archaebacterial enzyme -galactosidase in the yeast while maintaining identical molecular properties with high structural-functional similarities. It is notable that a purified archaebacterial RNA polymerase does not bind easily to a eubacterial promoter in vitro while it easily does so to a eukaryotic one in vitro. This is so because the purified archaebacterial RNA polymerase has a consensus sequence located upstream of the transcriptional site (required for in vitro transcription) that is highly homologous to the eukaryotic polymerase 2 promoters (Moracci et al, 1992). Since -galactosidase is not native to S. cerevisiae the sole purpose of its induced expression in the yeast is to assist in assessing the promoted levels of the hsp26 gene that shall initiate its synthesis sympathetic activation of its encoding gene, possibly lacS. Heat Shock Transcription Factors: One very important point to note about heat shock genes that encode heat shock proteins is that they contain heat shock elements within their sequences that are usually upsteam of their encoded sites. These heat shock element sites, usually within the heat shock consensus, are sites, the GAA/TTC nucleotide sequences together with their attendant 2-nucleotide groupings, are where heat shock transcription factors, hsf1 in the case of hsp26, bind to initiate transcription (Amin et al, 1988). In context of the above findings the paper finds that using the hsp26 D. melanogaster for assessing stress response other than heat stress in S. cerevisiae will be extremely difficult. This is so because the protein is not activated by the broader STRE pathways but by the narrower HSF/HSE pathway that is specific in action to heat stress. Nevertheless, the other stress responses in S. cerevisiae may include hsp26 induction and this possibility will be investigated in the paper's project. Thus, while the paper shall focus on heat stress in the yeast to better understand how hsp26 can be induced together with its subsequent activation of the -galactosidase enzyme encoding gene it will also touch upon other stress responses in the yeast to investigate whether there is one response other than to heat stress where hsp26 is activated. Thermal Stress Heat Shock: The Amin et al, 1988, study on heat shock regulatory mechanisms in organisms was one of the best and most fruitful ever conducted. Thus, the paper consults it in developing a strategy for investigating heat shock characteristics in S. cerevisiae. Amin et al transfected D. melanogaster S3 cells with 88 and 50 nucleotides length plasmids constructed out of Drosophila hsp70 gene segments that included the nontranscribed sequence, the entire RNA leader region and first seven hsp70 codons. These were then linked to truncated -galactosidase genes (Amin et al, 1988). Both plasmid constructs contained the Xho1 linkers ends of their Drosophila hsp70 promoter regions (Amin et al, 1988). The transfected cells were treated for 2 min with HEPES salts including enzymatically active 0.6 -galactosidase. Thereafter they were subjected to heat stress for 2 hours duration. The stress temperature is not given. Amin et al, 1988, got the following results. They had prepared three other kinds of the S3 cells besides those transfected with the two plasmid constructs. The first type was a set of mock-transfected cells, the second was a set of control cells that were kept at a constant optimal temperature of C throughout the experiment and the third type was transfected cells that were not subjected to heat treatment. 1. It was found that all three types of cells - the control cells, the mock-transfected ones and the transfected cells untreated with heat - did not show any significant -galactosidase activity. 2. In sharp contrast transfected cells treated with heat for 2 hours showed 50-fold increase in -galactosidase activity. This is significant success and suggests that the paper's project can use plasmids constructed out of the heat shock regulatory element segment (possibly the nontranscribed region, the entire RNA leader region and the first few codons as per Amin et al, 1988) of the D. melanogaster hsp26 gene and affix it to truncated -galactosidase genes with their coding regions intact. Such plasmids can then be transfected into suitable S. cerevisiae cell lines to conduct a mutation analysis of if heat treatment induces such transfected cells to produce significant amounts of -galactosidase enzyme. The lacS gene from Sulfolobus solfataricus can be used as a coding source of the enzyme. 3. Amin et al also prepared other constructs that substituted parts of the essential heat shock consensus sequence. They found that while some of these proved to be active mutants others, especially those that had essential nucleotide arrangements substituted with variant sequences, proved to be inactive. The Amin et al, 1988, experiments can be used as a guiding one for the paper's project. Cold Shock: The cold stress response in S. cerevisiae is interesting. There are two sets of genes involved - the first set defined as the early response when the temperature is lowering and the second set defined as the late response when the cold has set in. Genes in this set are unique and have no commonality with the general environmental stress response genes (Schade et al, 2004). It is found that early set of genes is transcribed independent of the Msn2p/Msn4p pathways. In contrast, this pathway transcribes the late set and many genes in this set has commonality with the general environmental stress response genes (Schade et al, 2004). Schade et al assume that the early phase may be of genes involved in adjustments in membrane fluidity and destabilisation of RNA secondary structures to allow efficient protein translation. The late phase, in contrast, is the general environmental response and is a result of the altered physiological state induced by the activated early phase genes with decreased transport, accumulation of misfolded proteins and reduced enzyme activity (Schade et al, 2004). No mention is made of the hsp26 gene in the two cold stress responses and, thus, there is very little scope to gather guidance for the paper from the studied literature on cold stress response in S. cerevisiae. Osmotic Stress High osmolarity induced by sweetening agents in the baking process is a big problem. It reduces the yeast's capability to ferment properly and produce sufficient gas. S. cerevisiae adapt to high osmolarity through the HOG (high-osmolarity-glycerol-response) mitogen-activated-protein (MAP) kinase pathway. Genes involved in glycerol synthesis such as GPD1 and GPP2 are induced by the Msn2p/Msn4p stress response pathways but, in addition to this, other stress response transcriptional factors are also involved (Rep et al, 1999). Two structurally associated nuclear factors Msn1p and Hot1p (high-osmolarity-induced-transcription) are also involved in the induction. Cells lacking in these four transcriptional factors are unable to initiate a short-term transcriptional response to osmotic stress because they cannot initiate the genes GPD1, GPP2, CTT1 and HSP12 (Rep et al, 2005). Another feature of note in the S. cerevisiae response to hyperosmolarity is the accumulation of glycerol to recover turgor pressure inside the cells. Many genes implicated in the response were found to be also implicated in protection from oxidative stress (Krantz et al, 2004). This was so because these genes recovered redox balance through glycerol production, a strategy similar to that adopted to deal with osmotic shock (Krantz et al, 2004). The gene response was similar in the case of both aerobic and anaerobic conditions though cells recovered faster under osmotic shock under anaerobic conditions with faster gene response. This was so because under anaerobiosis glycerol production is already enhanced to recover redox balance. Stimulated glycerol production under aerobic conditions produced a faster response to osmotic shock than under non-stimulated aerobic conditions (Krantz et al, 2004). No mention is made of the hsp26 gene in this instance. As with cold shock, osmotic shock is not dealt with in greater detail here as it does not comprise the main purpose of this paper since there is no recorded activation of the hsp26 gene. Other stress responses like exposure to heavy metals and radiation and oxidative shocks (Rodrigues-Pousada et al, 2005) will be included hereafter in some small detail. Other Stress Responses Heavy Metal Shock: Cells, yeast cells as well, need heavy metals like copper, zinc, iron and manganese to thrive properly by when their quantities increase beyond a certain level they can cause severe damage to internal structures. Thus, the yeast response to heavy metal stress is over expression of certain genes that encode proteins involved in stabilising and folding of other proteins in an oxidative environment, one induced by high incidence of heavy metals. Such genes are initiated by the transcription factors YAP1 and YAP2 (Rodrigues-Pousada et al, 2005). Arsenic and cadmium stress is independently initiated by the transcription factor YAP8 (Rodrigues-Pousada et al, 2005) which helps express genes - Acr1, Acr2 (encodes for arsenate reductase) and Acr3 ( encodes plasma membrane arsenite efflux protein) - all members of the arsenic compounds-resistance cluster (Acr) (Rodrigues-Pousada et al, 2005). YAP 8 also activates the YCF1 (Yeast cadmium factor) gene to generate an independent cadmium response (Rodrigues-Pousada et al, 2005). pH Shock: Short-chain organic acids, weak acids, such as sorbate, benzoate and propionate prevent microbial growth and are used in food and beverage preservation (Schuller et al, 2003). It is conjectured that their utility in this sense is because they can induce cytoplasmic acidification and inhibit metabolic activity. Also, benzoate and sorbate, being lipophilic, change membrane permeability (Schuller et al, 2003). The general acid stress response follows the Msn2p/Msn4p activation pathway but another gene highly implicated in this in a Msn2p/Msn4p activation pathway independent manner is the ATP binding cassette (ABC) efflux pump Pdr12p (Schuller et al, 2003). It inhibits intracellular anion accumulation and is a major weak acid response agent in yeast like S. cerevisiae. It is induced by the transcription factor WAR1 (Schuller et al, 2003). Another point of great interest to the paper is the inclusion of heat shock protein genes hsp30 and hsp26 in the yeast weak acid stress. They are accompanied by the plasma membrane -ATPase Pma1p gene (Schuller et al, 2003). Citric acid stress is mediated by the high osmolarity glycerol (HOG) mitogen-activated protein kinase (MAPK) pathway. Deletion of genes HOG1, SSK1, PBS1, PTC2, PTP2 and PTP3 resulted in sensitivity to citric acid in S. cerevisiae (Lawrence et al, 2004). Radiative Shock: Ionising radiation like UV and -rays cause extensive cell damage and the stress response in S. cerevisiae include the usual environmental stress response genes mediated by the Msn2p/Msn4p pathways (including the hsp26 gene involved in single-strand DNA repair) and the "DNA damage signature" defined by Gasch et al (Fry et al, 2006). The :DNA damage signature" genes are a set of nine genes that are specifically overexpressed under radiation stress and include - RAD51 and RAD54 (DNA damage repair), RNR2 and RNR4 (ribinucleotide reductase subunits), DUN1 (DNA damage activated kinase) and YER004W and YBR070C (uncharacterised genes). Of these DUN1, RAD51, RNR2 and YBR070C are involved in single-strand DNA break repair. The others are involved in double-strand break repair (Fry et al, 2006). Other new genes involved in radiation stress response are also being found presently and they have human homologs that are heavily involved in the aetiology of cancer (Birrell et al, 2001). Conclusion The hsp26 gene is an important member of the heat shock gene superfamily as it is a prime indicator of the nutritional status of yeast cells. It is induced during stationary phase and/or under starvation conditions and is repressed during growth in healthy medium (Panadero et al, 2005). The functional-structural characteristics of the hsp26 promoted protein is treated to some extent here but the project's purpose of investigating how and to what proportion the hsp26 gene is activated under stress responses other than to heat in S. cerevisiae is served to a great extent here. Such evidence of expression and levels of expression through mutation analysis with a -galactosidase colour assay can point to how the hsp26 gene helps the yeast to adapt to difficult conditions other than heat and thrive healthfully. This will certainly be of utility to food production as a healthy yeast population can be very effective as gas producers during the main utility of fermentation during food manufacturing processes as bread and wine making. Since the hsp26 protein is involved in single-strand break DNA repair and re-activation of heat-aggregated proteins it is very probable that the gene is expressed in many types of stress conditions where such work is necessary. Thus the project work should be quite successful in many respects. References Amin, Jahanshah, et al, Molecular and Cellular Biology, Sept. 1988, Vol. 8, No. 9, p. 3761-3769. Birrell, Geoff W., et al, A genome-wide screen in Saccharomyces cerevisiae for genes affecting UV radiation sensitivity, PNAS 2001; 98; 12608-12613. Cashikar, Anil G., et al, A Chaperone Pathway in Protein Disaggregation, J. Biol. Chem., Vol. 280, Issue 25, p. 23869-23875, June 2005. Fry, Rebecca C., et al, The DNA-damage signature in Saccharomyces cerevisiae is associated with single-strand breaks in DNA, BMC Genomics, 2006, 7:313. Krantz, Marcus, et al, Anaerobicity prepares Saccharomyces cerevisiae Cells for Faster Adaptation to Osmotic Shock, Eukaryotic Cell, December 2004, p, 1381-1390, Vol. 3, No. 6. Lawrence Clare L. et al, Evidence of a new Role for the High Osmolarity Glycerol Mitogen-Activated Protein Kinase Pathway in Yeast: Regulating Adaptation to Citric Acid Stress, Molecular and Cellular Biology, April 2004, p. 3307-3323, Vol. 24, No. 8. Lu, Qin, et al, , Repeats and Heat Shock Elements Have Distinct Roles in Chromatin Structure and Transcriptional Activation of the Drosophila Hsp26 Gene, Molecular and Cellular Biology, May 1993, p. 2802-2814, Vol. 13, No. 5. Moracci, Marco, et al, Expression of the Thermostable -Galactosidase Gene from the Archaebacterium Sulfolobus solfataricus in Saccharomyces cerevisiae and Characterisation of a New Inducible Promoter for Heterologous Expression, Journal of Bacteriology, Feb. 1992, Vol. 174, No. 3, p. 873-882. Panadero, Joaquin, et al, Validation of a Flour-Free Model Dough System for Throughput Studies of Baker's Yeast, Applied and Environmental Microbiology, March 2005, p. 1142-1147, Vol. 71, No. 3. Rep, Martijn, et al, Osmotic Stress-Induced Gene Expression in Saccharomyces cerevisiae Requires Msn1p and the Novel Nuclear Factor Hot1p, Molecular and Cellular Biology, August 1999, p. 5474-5485, Vol. 19, No. 8. Rodrigues-Pousada, Claudina, et al, The yeast stress response - Role of the Yap family of the b-ZIP transcription factors, FEBS Journal, 272 (2005); 2639-2647. Rodriguez-Vargas, Sonia, et al, Gene Expression Analysis of Cold and Freeze Stress in Baker's Yeast, Applied and Environmental Microbiology, June 2002, p. 3024-3030, Vol. 68, No. 6. Saccharomyces cerevisae RM11-1a, Taxonomy ID: 285006, National Center for Biotechnology Information (NCBI), Bethesda, Maryland, USA. Extracted on 26th February, 2007, from: http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgimode=Info&id=285006&lvl=3&p=mapview&p=has_linkout&p=blast_url&p=genome_blast&lin=f&keep=1&srchmode=1&unlock Saccharomyces, Wikipedia Online Encyclopedia, 2007. Extracted on 26th February, 2007, from: http://en.wikipedia.org/wiki/Saccharomyces#Morphology Schade, Babette, et al, Cold Adaptation in Budding Yeast, Molecular Biology of the Cell, December 2004, Vol. 15, Issue 12, 5492-5502. Treger, Janet M., et al, Transcriptional Factor Mutations Reveal Regulatory Complexities of Heat Shock and Newly Identified Genes in Saccharomyces cerevisiae, J Biol Chem, Vol. 273, Issue 41, p. 26875-26879, Oct. 1998. Wotton, David, et al, Multimerisation of Hsp42, a Novel Heat Shock Protein of Saccharomyces cerevisiae, is Dependent on a Conserved Carboxyl-terminal Seqeunce, JBC, Vol. 271, No. 5, February, 1996, pp. 2717-2723. Read More